ID: 985145438_985145448

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 985145438 985145448
Species Human (GRCh38) Human (GRCh38)
Location 4:186890287-186890309 4:186890331-186890353
Sequence CCCCAGCAGTGCCGGCCCACCGG GTGCCTTAGCTGCCTCCCCTCGG
Strand - +
Off-target summary {0: 148, 1: 527, 2: 450, 3: 241, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!