ID: 985145438_985145451

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 985145438 985145451
Species Human (GRCh38) Human (GRCh38)
Location 4:186890287-186890309 4:186890336-186890358
Sequence CCCCAGCAGTGCCGGCCCACCGG TTAGCTGCCTCCCCTCGGGCAGG
Strand - +
Off-target summary {0: 148, 1: 527, 2: 450, 3: 241, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!