ID: 985145440_985145453

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 985145440 985145453
Species Human (GRCh38) Human (GRCh38)
Location 4:186890288-186890310 4:186890341-186890363
Sequence CCCAGCAGTGCCGGCCCACCGGC TGCCTCCCCTCGGGCAGGGCTGG
Strand - +
Off-target summary {0: 121, 1: 490, 2: 425, 3: 286, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!