ID: 985323297_985323303

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 985323297 985323303
Species Human (GRCh38) Human (GRCh38)
Location 4:188738485-188738507 4:188738512-188738534
Sequence CCTTCCTCGAGCGCCAGGCGGGG AAGCCCATTTGAAGGTCAGGAGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 0, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!