ID: 985323300_985323307

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 985323300 985323307
Species Human (GRCh38) Human (GRCh38)
Location 4:188738498-188738520 4:188738528-188738550
Sequence CCAGGCGGGGTCTGAAGCCCATT CAGGAGGCCCGAGTTGCTGGCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 25, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!