|
Left Crispr |
Right Crispr |
Crispr ID |
985378567 |
985378570 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:189368283-189368305
|
4:189368315-189368337
|
Sequence |
CCACTTGGGTTAGCCTGTAACAT |
AAAAAAAAAGAAAGAAAATGAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 35, 1: 295, 2: 1821, 3: 15765, 4: 67232} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|