ID: 985378567_985378571

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 985378567 985378571
Species Human (GRCh38) Human (GRCh38)
Location 4:189368283-189368305 4:189368316-189368338
Sequence CCACTTGGGTTAGCCTGTAACAT AAAAAAAAGAAAGAAAATGAGGG
Strand - +
Off-target summary No data {0: 6, 1: 101, 2: 1080, 3: 10702, 4: 62182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!