ID: 985403787_985403799

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 985403787 985403799
Species Human (GRCh38) Human (GRCh38)
Location 4:189616569-189616591 4:189616617-189616639
Sequence CCCAGCTGGCTTCACCCAGTGGA CTGCCTGCCAGTCCCGCGCCGGG
Strand - +
Off-target summary {0: 849, 1: 786, 2: 340, 3: 179, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!