ID: 985403788_985403794

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 985403788 985403794
Species Human (GRCh38) Human (GRCh38)
Location 4:189616570-189616592 4:189616589-189616611
Sequence CCAGCTGGCTTCACCCAGTGGAT GGATCCCGCACAGGGGCTGCAGG
Strand - +
Off-target summary {0: 862, 1: 802, 2: 346, 3: 181, 4: 237} {0: 38, 1: 317, 2: 516, 3: 423, 4: 563}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!