ID: 985571147_985571151

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 985571147 985571151
Species Human (GRCh38) Human (GRCh38)
Location 5:646019-646041 5:646069-646091
Sequence CCCATCGGCGGCCTGTGTGGACA AGCGTCACTCTTGCTCCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 48} {0: 2, 1: 0, 2: 3, 3: 16, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!