ID: 985620425_985620431

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 985620425 985620431
Species Human (GRCh38) Human (GRCh38)
Location 5:952151-952173 5:952167-952189
Sequence CCCCTGGGTGGGCTCATGTGGCC TGTGGCCCTGGGAGAGCTGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 59, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!