ID: 985645231_985645241

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 985645231 985645241
Species Human (GRCh38) Human (GRCh38)
Location 5:1081818-1081840 5:1081855-1081877
Sequence CCCGGCAGGTGCCACTGGTGGCC ACAGCTTGTGCGCCGCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 247} {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!