ID: 985645237_985645241

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 985645237 985645241
Species Human (GRCh38) Human (GRCh38)
Location 5:1081829-1081851 5:1081855-1081877
Sequence CCACTGGTGGCCGGAGGGGAAGG ACAGCTTGTGCGCCGCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 310} {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!