ID: 985734965_985734977

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 985734965 985734977
Species Human (GRCh38) Human (GRCh38)
Location 5:1574185-1574207 5:1574238-1574260
Sequence CCCAGTGCCAACGTCCACATAGG AGGGCTTCTTCTGTTGCCCCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 2, 4: 72} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!