ID: 985739013_985739026

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 985739013 985739026
Species Human (GRCh38) Human (GRCh38)
Location 5:1603926-1603948 5:1603976-1603998
Sequence CCTCCCAACTTCCCCTTGGGAAG AAGCTGTGCTCTTCCCACAAAGG
Strand - +
Off-target summary No data {0: 7, 1: 9, 2: 2, 3: 28, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!