ID: 985783516_985783533

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 985783516 985783533
Species Human (GRCh38) Human (GRCh38)
Location 5:1882602-1882624 5:1882654-1882676
Sequence CCTGGGGAGCCGAGGAGTAGGGG CGCGGCCCGGGGCGGACGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 290} {0: 1, 1: 2, 2: 3, 3: 47, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!