ID: 985895919_985895924

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 985895919 985895924
Species Human (GRCh38) Human (GRCh38)
Location 5:2750078-2750100 5:2750122-2750144
Sequence CCTTGCACGTGCGCGCACACAGG TCTAAATTTCTGCAGATGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 132} {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!