ID: 986026269_986026284

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 986026269 986026284
Species Human (GRCh38) Human (GRCh38)
Location 5:3854418-3854440 5:3854466-3854488
Sequence CCTGGCGCGCTCGGGAGGAATGC TGTGGGCCGGCTGCGATAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!