ID: 986089792_986089798

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 986089792 986089798
Species Human (GRCh38) Human (GRCh38)
Location 5:4493082-4493104 5:4493121-4493143
Sequence CCAGCTTTGCTGAAGTGAGTGCT AGTGGACACAGGCAGGCCTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!