ID: 986113881_986113887

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 986113881 986113887
Species Human (GRCh38) Human (GRCh38)
Location 5:4750339-4750361 5:4750381-4750403
Sequence CCTCCCAGCTGCTTTCATGGCCT TTTTCCAAGCACATGGTGCAAGG
Strand - +
Off-target summary {0: 4, 1: 175, 2: 315, 3: 852, 4: 1363} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!