ID: 986113883_986113887

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 986113883 986113887
Species Human (GRCh38) Human (GRCh38)
Location 5:4750342-4750364 5:4750381-4750403
Sequence CCCAGCTGCTTTCATGGCCTGGT TTTTCCAAGCACATGGTGCAAGG
Strand - +
Off-target summary {0: 3, 1: 86, 2: 383, 3: 853, 4: 1264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!