ID: 986488533_986488536

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 986488533 986488536
Species Human (GRCh38) Human (GRCh38)
Location 5:8265695-8265717 5:8265716-8265738
Sequence CCGACATCAGATGGTTCACCCGC GCCTCAGCCTCCCAAAGTGCTGG
Strand - +
Off-target summary No data {0: 56931, 1: 168651, 2: 218048, 3: 269456, 4: 306914}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!