ID: 986612087_986612089

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 986612087 986612089
Species Human (GRCh38) Human (GRCh38)
Location 5:9579047-9579069 5:9579071-9579093
Sequence CCCAGAGATGTCAAGATGTTTCT AAAGTCACACAGCTAATAAATGG
Strand - +
Off-target summary No data {0: 13, 1: 50, 2: 372, 3: 1467, 4: 3959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!