|
Left Crispr |
Right Crispr |
| Crispr ID |
987016184 |
987016191 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:13822356-13822378
|
5:13822372-13822394
|
| Sequence |
CCCTCCCACCTCAGCATCCAGAG |
TCCAGAGTAGATGGGACTATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 43, 2: 524, 3: 1353, 4: 2718} |
{0: 7, 1: 474, 2: 13152, 3: 134596, 4: 261264} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|