|
Left Crispr |
Right Crispr |
Crispr ID |
987016184 |
987016193 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:13822356-13822378
|
5:13822379-13822401
|
Sequence |
CCCTCCCACCTCAGCATCCAGAG |
TAGATGGGACTATAGGCACATGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 43, 2: 524, 3: 1353, 4: 2718} |
{0: 1, 1: 14, 2: 146, 3: 540, 4: 1414} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|