ID: 987061727_987061732

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 987061727 987061732
Species Human (GRCh38) Human (GRCh38)
Location 5:14249802-14249824 5:14249817-14249839
Sequence CCCAGAGCAGCTTCATTTGATGG TTTGATGGTGGGAGAGAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 125} {0: 1, 1: 1, 2: 3, 3: 37, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!