ID: 987303459_987303463

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 987303459 987303463
Species Human (GRCh38) Human (GRCh38)
Location 5:16617121-16617143 5:16617135-16617157
Sequence CCACAGGCCACGGAGGGGGAGCC GGGGGAGCCGCCCGGGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 256} {0: 1, 1: 0, 2: 2, 3: 13, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!