ID: 987310035_987310038

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 987310035 987310038
Species Human (GRCh38) Human (GRCh38)
Location 5:16673182-16673204 5:16673199-16673221
Sequence CCAGATGACGTTTTTTTTTTTTC TTTTTCCATAAGAAGCCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 27, 3: 495, 4: 4554} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!