ID: 987351866_987351876

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 987351866 987351876
Species Human (GRCh38) Human (GRCh38)
Location 5:17029537-17029559 5:17029553-17029575
Sequence CCCCCAACAATCCCATTAAAAAG TAAAAAGTGGGCAAATGGCCGGG
Strand - +
Off-target summary No data {0: 7, 1: 22, 2: 76, 3: 253, 4: 855}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!