ID: 987351868_987351877

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 987351868 987351877
Species Human (GRCh38) Human (GRCh38)
Location 5:17029539-17029561 5:17029561-17029583
Sequence CCCAACAATCCCATTAAAAAGTG GGGCAAATGGCCGGGTGCGCTGG
Strand - +
Off-target summary {0: 15, 1: 168, 2: 469, 3: 582, 4: 1014} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!