ID: 987351872_987351879

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 987351872 987351879
Species Human (GRCh38) Human (GRCh38)
Location 5:17029548-17029570 5:17029588-17029610
Sequence CCCATTAAAAAGTGGGCAAATGG CGCCTGTAATCCCAGCACTTTGG
Strand - +
Off-target summary No data {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!