ID: 987816077_987816092

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 987816077 987816092
Species Human (GRCh38) Human (GRCh38)
Location 5:22902110-22902132 5:22902160-22902182
Sequence CCTCCCAGGCCCCTGAGTGCCCA GGGTGGCTGCAGCTGCGCCCAGG
Strand - +
Off-target summary No data {0: 5, 1: 55, 2: 185, 3: 349, 4: 768}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!