ID: 988038850_988038853

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 988038850 988038853
Species Human (GRCh38) Human (GRCh38)
Location 5:25861986-25862008 5:25862012-25862034
Sequence CCATATTACTATCAGCATTTTGG AAACCATTCAACAAGTCTGTAGG
Strand - +
Off-target summary {0: 89, 1: 1245, 2: 1904, 3: 1509, 4: 1023} {0: 7, 1: 404, 2: 2082, 3: 2004, 4: 1293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!