ID: 988174954_988174957

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 988174954 988174957
Species Human (GRCh38) Human (GRCh38)
Location 5:27710875-27710897 5:27710901-27710923
Sequence CCATGAACCATGACCATATAAGA CAAACTTAATTGATAAATGTTGG
Strand - +
Off-target summary No data {0: 2, 1: 4, 2: 4, 3: 23, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!