ID: 988218937_988218945

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 988218937 988218945
Species Human (GRCh38) Human (GRCh38)
Location 5:28316524-28316546 5:28316556-28316578
Sequence CCCAAATCTAGAGAGGCCCACAG ACGTTTCTTAATAGTGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!