ID: 988358232_988358236

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 988358232 988358236
Species Human (GRCh38) Human (GRCh38)
Location 5:30203508-30203530 5:30203528-30203550
Sequence CCATACAAAGGTCCGACCAGACC ACCTAGGAGAAACTCCCTTCAGG
Strand - +
Off-target summary {0: 41, 1: 115, 2: 101, 3: 52, 4: 54} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!