ID: 988410643_988410647 |
View in Genome Browser |
Spacer: -2 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 988410643 | 988410647 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:30881392-30881414 | 5:30881413-30881435 |
Sequence | CCTCCATCTTTGTGTTCACTTTG | TGGGCCCACAACAAATTAAATGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |