ID: 988551468_988551476

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 988551468 988551476
Species Human (GRCh38) Human (GRCh38)
Location 5:32204542-32204564 5:32204579-32204601
Sequence CCTGCACAAGACCCTTTGGATTC CGCTCCTCCAGACCACTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!