ID: 988577972_988577980

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 988577972 988577980
Species Human (GRCh38) Human (GRCh38)
Location 5:32444742-32444764 5:32444770-32444792
Sequence CCGCCGCCTCCGACCGCACTGCG GCGCCTGTGCTCGGCATCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 232} {0: 1, 1: 0, 2: 0, 3: 6, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!