ID: 988577973_988577980

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 988577973 988577980
Species Human (GRCh38) Human (GRCh38)
Location 5:32444745-32444767 5:32444770-32444792
Sequence CCGCCTCCGACCGCACTGCGCAG GCGCCTGTGCTCGGCATCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 83} {0: 1, 1: 0, 2: 0, 3: 6, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!