ID: 988676726_988676733

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 988676726 988676733
Species Human (GRCh38) Human (GRCh38)
Location 5:33440684-33440706 5:33440723-33440745
Sequence CCGGGAAGGTCCATGATTGTTCC GAGGAAAGGCGCACGCGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 111} {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!