ID: 988766409_988766414

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 988766409 988766414
Species Human (GRCh38) Human (GRCh38)
Location 5:34382266-34382288 5:34382305-34382327
Sequence CCCTGCCATCTTTTGCAGATAAC GACAGGTCTTGGCCTATTACTGG
Strand - +
Off-target summary {0: 6, 1: 192, 2: 177, 3: 141, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!