ID: 988766411_988766414

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 988766411 988766414
Species Human (GRCh38) Human (GRCh38)
Location 5:34382271-34382293 5:34382305-34382327
Sequence CCATCTTTTGCAGATAACTACTC GACAGGTCTTGGCCTATTACTGG
Strand - +
Off-target summary {0: 5, 1: 185, 2: 202, 3: 119, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!