ID: 988868375_988868379

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 988868375 988868379
Species Human (GRCh38) Human (GRCh38)
Location 5:35360617-35360639 5:35360664-35360686
Sequence CCTCCAAAGTGAACTATCAAACA AAAAAGAACACTGTACATTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 51, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!