ID: 988936540_988936545

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 988936540 988936545
Species Human (GRCh38) Human (GRCh38)
Location 5:36089011-36089033 5:36089044-36089066
Sequence CCCTGTAAAACCACCACCGAAGT AACGTAGCCAGCAATCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 57} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!