ID: 989120946_989120953

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 989120946 989120953
Species Human (GRCh38) Human (GRCh38)
Location 5:38004034-38004056 5:38004066-38004088
Sequence CCCTCTCTGAGTTGTCTAAGAAC TGCTTCCCTGGGGGCTTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!