ID: 989545338_989545345

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 989545338 989545345
Species Human (GRCh38) Human (GRCh38)
Location 5:42665964-42665986 5:42665991-42666013
Sequence CCCCCATGATTCAATTACCTTCC GCTCCCTCTCATGACACATGCGG
Strand - +
Off-target summary {0: 184, 1: 3372, 2: 6558, 3: 9434, 4: 9921} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!