|
Left Crispr |
Right Crispr |
| Crispr ID |
989545340 |
989545350 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:42665966-42665988
|
5:42666002-42666024
|
| Sequence |
CCCATGATTCAATTACCTTCCAC |
TGACACATGCGGATTATGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 166, 1: 3359, 2: 6675, 3: 9465, 4: 10447} |
{0: 1, 1: 2, 2: 1, 3: 17, 4: 84} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|