|
Left Crispr |
Right Crispr |
Crispr ID |
989545342 |
989545348 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:42665981-42666003
|
5:42665998-42666020
|
Sequence |
CCTTCCACCAGCTCCCTCTCATG |
CTCATGACACATGCGGATTATGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 5, 2: 98, 3: 701, 4: 2378} |
{0: 2, 1: 47, 2: 581, 3: 1510, 4: 2895} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|