ID: 989545342_989545353

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 989545342 989545353
Species Human (GRCh38) Human (GRCh38)
Location 5:42665981-42666003 5:42666030-42666052
Sequence CCTTCCACCAGCTCCCTCTCATG TTCAAGATGTGATTTGTATGGGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 98, 3: 701, 4: 2378} {0: 1, 1: 12, 2: 828, 3: 9875, 4: 12509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!